WWW.DISSERTATION.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Dissertations, online materials
 
<< HOME
CONTACTS



Pages:     | 1 |   ...   | 6 | 7 || 9 | 10 |   ...   | 15 |

«(落葉樹の根圏動態に対する高CO2とO3及び高窒素負荷の影響に関する研究) Wang Xiaona 王 晓娜 Division of ...»

-- [ Page 8 ] --

The colonization rate, together with diversity of different ECM species, was estimated using a distance-based redundancy analysis (db-RDA) among the four gas treatments. The db-RDA depends on the matrix created using ECM species and the four treatments, and it calculates the eigenvalues and their contribution to the squared Bray distance. The results of the ANOVA use permutation tests for capscale under a reduced model (CAP1, CAP2, and CAP3 are shown). Independent variables are identified as factors (Treat.) CAP1 and CAP2 refer to axis 1 and axis 2 information, respectively, and they represent the proportion explained by the difference between each treatment. From the R results, we determined that the directions of both axis 1 (P = 0.005) and axis 2 (P = 0.005) were significantly different. This result indicates that the abundance of colonized ECM species from elevated O3 and mixed conditions was largely different from that of control and elevated CO2 conditions (axis 1 direction). Between elevated O3 and mixed conditions, the abundance of ECM species was also markedly changed (explained by axis 2). An asterisk refers to significant codes: **P 0.01.

–  –  –

O3 CO2 + O3 Figure 3.4 Changes in the abundance of the ECM community of the four treatments.

Each value is the proportion of each type of ECM identified with the hybrid larch F1

under the four types of fumigation (a, b, c, d). a: Tomentella sp. B: Peziza sp. C:

Suillus laricinus D: S. grevillei E: Cadophora finlandia F: Laccaria cf. laccata

–  –  –

Figure 3.5 Net photosynthetic rate of growth under [CO2] concentrations (Agrowth) and stomatal conductance (Gs).

Each value is the mean of four chamber replications, and the vertical bar indicates the standard error. Different character symbol denote significant differences between the four treatments (P 0.05). ANOVA: *P 0.05, **P 0.01, “ns” means not significant.

–  –  –

4.1 INTRODUCTION Nitrogen (N) deposition is increasing sharply in northeast Asia, including Northwestern China (Liu et al. 2013), South Korea (Park et al. 2002), and Japan (Morino et al. 2011), as a result of rapid industrial development and overuse of N fertilizer (e.g. Galloway et al. 2008). Nitrogen is often one of the most limiting nutrients in many terrestrial ecosystems (Schulze et al. 2005; LeBauer et al. 2008), thus chronic N deposition can alter ecosystem function (Smith et al. 2009). Such altered ecosystem functions have been documented in soils (Paul 2007) where microbes play a major role in energy and nutrient cycling (Frey et al. 2004). One group of such soil microbes is mycorrhizal fungi which have symbiotic relationships with 80% of the terrestrial vascular plant species (Smith et al. 2003). Importantly, mycorrhizal fungi improve the survival in the harsh environmental conditions in forests (Smith and Read 1997; 2008; Qu et al. 2010; Agerer 2012).

In infertile soil, ectomycorrhizal fungi (ECMF) efficiently supply phosphorus (P) and water to the host plants better than the plant root (Wallander 2000; Alves et al.

2010; Qu et al. 2010). Several studies reported this effective uptake of ECM-associated plants for organic P (Po) and nitrogen (N) was due to ECM production of extracellular enzymes, compared to non-infected plants of the same species (Turnbull et al. 1996; Van Der Heijden and Sanders 2002; Qu et al. 2004;

White and Hammond 2008). Moreover the formation of extrametrical mycelia (EMM), which grow from the mantle into the root of the host plant from the surrounding soil, plays a major role in the translocation of nutrients and water, and even facilitates nutrient movement between individual host plants (Agerer 2001; 2012; Anderson and Cairney 2007).

–  –  –

Commonly, larch (Larix species) is a typical coniferous species which readily establishes symbiotic relationship with ECM fungi in harsh environments (Smith and Read 1997; Qu et al. 2004; 2010). As a dominant tree species in the northeastern part of Eurasia (Koike et al. 2000; Kayama et al. 2009; Mao et al. 2010), larch has been intensively planted for afforestation especially across Northern Japan (Ryu et al. 2009;

Qu et al. 2010), South Korea (Kim 2008) and Northeastern China (Hu et al. 2010; Sun et al. 2010; Zhao et al. 2011). To overcome biotic and abiotic stress, such as cold weather, wild animal graze and strong wind, etc., typical to the regions, a new hybrid larch, and known as F1 has been developed recently (Ryu et al. 2009). Previous study has found that ECM infection increases the growth of Japanese larch and F1 by a factor of 1.5-2.0 in nutrient-poor soil in northern Japan and central Russian forests (Qu et al. 2010). Is this relationship maintained under a changing environment, and in particular where there is increased high N deposition?

Many studies documented that N deposition changed relationship between the host plants and mycorrhizal fungi. For example, a study on a spruce forest across a stand-scale N deposition gradient (from 27 to 43 kg N ha−1yr−1) revealed that with increasing N deposition, ECM root tip abundance and mycelial production decreased five and 10-fold, and ECMF community changed and the species richness decreased (Kjoller et al. 2012). According to the study of Lilleskov et al. (2002), composition of ECM species shifted from N-uptake to N-tolerant species with N loading, and given that under high-N, low-P and acidified conditions, the ECM species changed to favor types specialized for P uptake.





Furthermore, P availability is regarded to be a limited factor to tree growth due to several mechanisms, such as P depletion, soil barriers, especially the interaction with N deposition (Vitousek et al. 2010). P exists in soil in both inorganic and organic

–  –  –

forms, and with low concentration in the soil solution (Hinsinger 2001), especially immature volcanic ash soil (e.g. Kayama et al. 2009). Recently, some studies have been reported that ECMF contribute significantly to weathering processes of apatite substrates (Alves et al. 2010), and uptake of P from soil where with poor soluble sources (Aquino and Plassard 2004). Japan is part of the Pacific ‘Ring of Fire,’ and most forest soils derive from volcanic ash soil, which is deficient in P content (e.g.

Schmincke 2004). Chronic deposition of atmospheric N potentially limits the utilization of P in a broad range of forest ecosystems (Gradowski and Thomas 2006).

However, as I mentioned above, ECMF assisted the P acquisition from heterogeneous soil sources in forest ecosystems (Buscot et al. 2000; Alves et al. 2010). Baxter and Dighton (2005) reported host trees having a diverse ECM fungal species are regarded as equally efficient in mediating abundant P acquisition as trees with fewer ECM species. Additionally, the growth of many host trees is enhanced when they are infected by multiple ECM species rather than a single, including larches (Qu et al.

2004; 2010), three kinds of pine species and the Japanese larch (e.g. Choi, 2008).

Contrary, in some forests, the soil P status exerts a selective influence on ECM fungal community composition (Morris et al. 2008; Dickie et al. 2009). Therefore the unclear symbiotic interaction is vital to successful forest establishment in infertile soil conditions (Dahlberg 2001; Smith 2002; Koike et al. 2010).

Although larch is important as plantation species in northern Japan, few studies exist regarding the symbiotic relationship between ECM fungi and larch species with increasing N deposition (Qu et al. 2003b; Choi et al. 2005; Shinano et al. 2007).

Moreover, rather limited study has focused on ECM symbiosis in immature volcanic ash soil (Leski and Rudawska 2012). Already previous studies have found some advantaged growth character of hybrid larch F1 than their parents (Ryu et al. 2009),

–  –  –

there is still unclear information about the response of ECM symbiosis colonized with these three larch species under with N deposition. P as the second nutrient element after N, can further change mycorrhizal dynamics with an interaction of N deposition.

I hypothesize the species richness of ECMF with larches can be changed by N loading with or without P conditioning.

In this study, I examined how three larch species responded to N and P amendments. Specifically, trying to find some clues of larch species for afforestation in early stage, I consider four questions: (1) Is there an interactive effect between P and N fertilization on the extent of colonization of ECM fungi? (2) Does an increase in N deposition affect the diversity of ECM species colonizing host larches? And (3) Does ECM communities respond to nutrients differently among the three larch species?

(4) Are there variations in the community structure of ECM fungal species between host larch species? To answer these questions I conducted a model experiment using representative larch species, including the new hybrid F1, planted in simulated immature volcanic ash soils with differing N and P levels.

4.2 MATERIALS AND METHODS 4.2.1 Plants and soil materials This experiment was also conducted in Sapporo Experimental Forest of Hokkaido University, Japan (N43.07, E141.38, 15m a.s.l.). The snow-free period is from early May to early November. The average temperature at the experimental site during the growing period was 20.2 oC, and the relative air humidity during May to October was 74.3 %. In 2010 the monthly accumulated photosynthetic photon flux in July, August,

–  –  –

September and October was respectively 578.2, 625.2, 582.2 and 360.7 mol m-2.

I planted 3-year-old seedlings of three larches species in 15L pots. These were Dahurian larch (DL: Larix gmelinii var. japonica), originating from the Kuril Islands;

the Japanese larch (JL: L. kaempferi), which is native to central Japan; and their hybrid larch (F1) (L. gmelinii var. japonica × L. kaempferi), which has been successfully planted in northern Japan as a reforestation tree species having fast growth and high tolerance to cold (Ryu et al. 2009). JL and DL received from the same nursery near Bibai (Hokkaido Research Organization, Forestry Research Institute). Hybrid F1 had been cloned by the same institute and offered to us. I obtained these species after 3 years cultivation. All seedlings were kept in low temperature cabinets in a storeroom at our university before planting, to observe an initial ECM colonization and determine the initial diameter and height. The size of three larch species showed no difference. The average (±SD) value of diameter was 10.13 (± 0.35) mm, and their initial height was 30.75 (± 3.24) cm.

Soil of Kanuma-pumice and Akadama (both are well-weathered volcanic ash) were selected for this pot experiment, two kinds of soil were mixed in equal volumes.

Its physical and chemical property was same condition with Eguchi et al. (2008), soil PH and NH4+ concentration after nutrient treatment were detected (Table 4.1). These soils have low nutrient concentrations making them ideal for a nutrient-adding experiment and as an observational substrate for mycorrhiza.

4.2.2 Nutrient treatments The experiment was fully randomized. I set two levels of N (0 and 100 kg ha-1yr-1;

zero corresponding to N control), in combination with two levels of P (0 and 50 kg

–  –  –

ha-1yr-1), so as to cover all four combinations. The four treatments were denoted control (P0N0), high P (P50N0), high N (P0N100) and high P×N (P50N100), each treatment had six replicates. The concentration gradient was set according to a report that the average N deposition rates worldwide now exceed 10 kg ha-1 yr-1, and that by 2050 some regions in Asia will reach 50 kg ha-1 yr-1 (Galloway 2004; 2008).I used ammonium nitrate solution (NH4NO3) to simulate acid rain and potassium phosphate monobasic (KH2PO4) as fertilizer source, because NH4NO3 is a major component of recent acid rain in northern Japan. Potassium chloride (KCl) was used to equilibrate the potassium concentration. To prevent nutrient leaching from heavy rain, a matched tray was set in the bottom of each pot, and the collected water was returned to the same pot. Irrigation was applied manually avoiding desiccation, and N and P were applied with two weeks interval after one month from planting (for adapting soil condition). Treatments period started from June 2010 until October 2011 except the winter time (from November to April).

4.2.3 Colonization rate and diversity of ECM The ECM taxa were assessed via both morphological as well as molecular analyses, before planting and after harvesting (Table 4.2, 4.3). At the end of growing season, October, 2011, the entire seedlings were harvested and roots were stored in plastic bag covering by wet paper tissue and transferred to laboratory immediately, keeping in refrigerator at 4 oC. Within 3 days, the harvested roots were first washed until no clod and then gently cleaned the root tips using a paintbrush. Sampling method referred to Wang et al. (2015a). Finally, a microscope (Olympus szx-ILLK100, Japan) was used to observe the extent of colonization of ECM. Taxa of ECM were classified based on

–  –  –

morphological characteristics, including color, texture, ramification, root tip shape, and emanating hyphae (Grand and Harvey, 1982; Agerer 1987-1993). The taxonomic classification based on the morphology was verified via molecular analysis.

Ribosomal DNA (rDNA) of ECM was extracted from the root tips infected with ECM using a DNeasyTM Plant Mini Kit (QIAGEN). Internal transcribed spacer (ITS) was amplified via PCR using a primer set of ITS1-F (CTTGGTCATTTAGAGGAAG TAA) and ITS4-B (CAGGAGACTTGTACACGGTCCAG) (Gardes and Bruns 1993;

Bellemain et al. 2010). PCR reactions were performed using 50 µL assays: 5µL of 10 × PCR buffer, 5µL of 25 mM MgCl2, 4µLof a 0.2 mM dNTP mixture containing,



Pages:     | 1 |   ...   | 6 | 7 || 9 | 10 |   ...   | 15 |


Similar works:

«EC-LEDS ENHANCING CAPACITY FOR LOW EMISSION DEVELOPMENT STRATEGIES NATIONAL RENEWABLE ENERGY LABORATORY RENEWABLE ENERGY OPPORTUNITY ASSESSMENT FOR USAID MEXICO November 2015 Andrea Watson, Ricardo Bracho, Rachel Romero, Megan Mercer EC-LEDS is managed by the U.S. Agency for International Development (USAID) and Department of State with support from the U.S. Department of Energy, U.S. Environmental Protection Agency, U.S. Department of Agriculture, and U.S. Forest Service. Printed with a...»

«2013 South Dakota Crop Protection Guide Corn Weed Control (text) Weeds: Mike Moechnig, Darrell L. Deneke, Leon J. Wrage, Jill Alms, Dave Vos, and Mark Rosenberg Insects: Adrianna Szczepaniec and Buyung Hadi Diseases: Kay Ruden “This document represents only a portion of the 2013 Corn Crop Protection Guide. The complete guide is available at iGrow.org. Information in this publicationis based on SDSU and other research and observations and provides a summary of label recommendations. It is not...»

«Rural Sociology 78(1), 2013, pp. 1–28 DOI: 10.1111/j.1549-0831.2012.00095.x Copyright © 2012, by the Rural Sociological Society A More Perfect Commodity: Bottled Water, Global Accumulation, and Local Contestation Daniel Jaffee Department of Sociology *Washington State University Soren Newman School of the Environment Washington State University Abstract Bottled water sits at the intersection of debates regarding the social and environmental effects of the commodification of nature and the...»

«The Sword of Damocles: Pima Agriculture, Water Use and Water Rights, 1848-1921 Item type text; Electronic Dissertation Authors DeJong, David Henry Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author....»

«Case Study form the EETAP WG4 Draft Report: Representation and Who Decides in Energy Planning Case Study of Mae Moh Power Plant, Lampang The Mae Moh coalfired power plant is located in the mountains of the Mae Moh district in Lampang province, Northern Thailand. The fuel source of the power plant is a lignite coal mine occupying an area of 135 square kilometers, and is located near the plant itself. The plant consists of 13 generating units and has a capacity of 2,625 Megawatts, and is owned...»

«ENVIRONMENTAL AND AGRONOMIC EVALUATION OF VALUE-ADDED NITROGEN FORTIFIED POULTRY LITTER AND BIOSOLIDS FERTILIZERS ENVIRONMENTAL AND AGRONOMIC EVALUATION OF VALUE-ADDED NITROGEN FORTIFIED POULTRY LITTER AND BIOSOLIDS FERTILIZERS A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Crop, Soil, and Environmental Sciences By Mark Stephen Reiter Virginia Polytechnic Institute and State University Bachelor of Science in Crop and Soil...»

«THE JOURNEYS OF HUMBOLDT: A GUIDE TO EFRAIN OSCHER’S COMPOSITION FOR ORCHESTRA A Monograph Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Musical Arts in The School of Music by Bernardo Virgilio Miethe Flores B.M., The University of Southern Mississippi, 2010 M.M., The University of Southern Mississippi, 2012 May 2015 Acknowledgements After being a student of...»

«Dorinne Dorfman Planning and Changing Vol. 35, No. 3&4, 2004, pp. 143–153 THE LUCKIEST LITTLE HIGH SCHOOL: THE POSSIBILITIES AND PANGS OF COMMUNITY DEMOCRACY Introduction The rapid transformation of a secondary school from a bureaucratically regimented institution to a student-centered learning environment advocating democratic practices merits review. During its third year of progressive reform, this gem was discovered among the ashes of high-stakes assessment and corporate infiltration in...»

«Tsakiri, Ioannidis, Carty 1 LASER SCANNING ISSUES FOR THE GEOMETRICAL RECORDING OF A COMPLEX STATUE Maria TSAKIRI1, Charalambos IOANNIDIS1, Alistair CARTY2 1 School of Rural and Surveying Engineering, National Technical University of Athens, Greece. 2 Archaeoptics Ltd, Glasgow, UK KEY WORDS: laser scanning, heritage applications, three-dimensional, close range, data capture ABSTRACT Recent advances in laser scanning technology allow for fast and efficient 3D documentation of cultural heritage...»

«Research in ISSN : P-2409-0603, E-2409-9325 AGRICULTURE, LIVESTOCK and FISHERIES An Open Access Peer Reviewed Journal      Open Access Res. Agric. Livest. Fish. Research Article Vol. 2, No. 1, April 2015: 125-133 FISHERS ACCESS TO THE COMMON PROPERTY WATERBODIES IN THE NORTHERN REGION OF BANGLADESH Md. Amzad Hossain1*, Mousumi Das1, Md. Shahanoor Alam2 and Md. Enamul Haque3 1 Department of Aquaculture, Bangabandhu Sheikh Mujibur Rahman Agricultural University (BSMRAU), Gazipur-1706,...»

«The United Graduate School of agricultural sciences, Kagoshima University, Japan DEVELOPMENT STRATEGY OF THE AGRICULTURAL COOPERATIVES IN THE MEKONG DELTA, VIETNAM: SIGNIFICATION OF DIVERSIFICATION INTO BUSUNESS AND ACTITITIES ベトナム·メコンデルタにおける農業協同組合の開発戦略 TRAN MINH HAI 2014 i DEVELOPMENT STRATEGY OF THE AGRICULTURAL COOPERATIVES IN THE MEKONG DELTA, VIETNAM: SIGNIFICATION OF DIVERSIFICATION INTO BUSUNESS AND ACTITITIES...»

«DIALOGUES, DYSFUNCTIONAL TRANSITIONS, AND EMBODIED PLOT SCHEMAS: (RE) CONSIDERING FORM IN CHOPIN’S SONATAS AND BALLADES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College In partial fulfillment of the requirements for the degree of Doctor of Philosophy in The School of Music by Jonathan Mitchell B.M., Millsaps College, 2004 M.M., Louisiana State University, 2006 December 2012 ACKNOWLEDGMENTS I am grateful for the numerous...»





 
<<  HOME   |    CONTACTS
2016 www.dissertation.xlibx.info - Dissertations, online materials

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.