WWW.DISSERTATION.XLIBX.INFO
FREE ELECTRONIC LIBRARY - Dissertations, online materials
 
<< HOME
CONTACTS



Pages:     | 1 |   ...   | 10 | 11 || 13 |

«by CHIEH-TING WANG (Under the Direction of Jeffrey F. D. Dean) ABSTRACT Laccase and related laccase-like multicopper oxidases (LMCOs) have been ...»

-- [ Page 12 ] --

Figure 3.7.

GT7855 insertion line grown on MS medium without sucrose. A. 14-day-old wild-type (left) and GT7855 mutant (right) seedlings grown on MS medium without sucrose. B. Root growth during the first two weeks on different concentrations of sucrose after germination. GT7855 mutant line 3 was used to compare with wild type. At least 8 seedlings were measured in each treatment. Individual replicates were averaged and bars show one standard deviation. 0: without sucrose; 1: 1% sucrose;

45: 4.5% sucrose.

–  –  –

Figure 3.8.

Exogenous sugar enables growth of the GT7855 insertion mutant in soil. A. 21-day-old wild-type (WT) and GT7855 mutant (GT7855) seedlings grown in soil. Some GT7855 mutant seedlings (shown as GT7855+sucrose) were irrigated with sucrose solution (1%) on day 14 and day 17 after germination.

Picture was taken at day 22 after germination. GT7855 mutants, irrigated with water as a control, remained undeveloped. B.

Seedlings vertically grown on MS medium supplemented with different sugars (1%) as indicated and MS medium only as control. At least 8 seedlings were measured in each treatment and error bars represent S.D.

–  –  –

Figure 3.10.

At2g30210 promoter expression patterns. GUS activity was detected in tissues of different aged plants. A. 5 –day-old seedling on MS plate. B. 2-week-old in MS liquid culture. C. 2-week-old on MS plate. D. 5-week-old seedling on plates. E. Cross section taken from 1 cm behind the root tip of 5-week old seedling. F. Undeveloped flower stained for 3 days.

G. A high magnification of dissected anthers.

128 Figure 3.11. Developmental regulation of the At2g30210 promoter.

Promoter activity of At2g30210 was detected in a series of lateral roots in a single seedling. GUS activity is shown as the darkened zones.

–  –  –

Figure 3.12.

Subcellular localization of the At2g30210-EYFP chimeric protein in BY2 tobacco cells and transgenic Arabidopsis. BY2 cells were observed using a light microscope with UV illumination. Root tips from 5-day old seedlings were observed using confocal microscopy. A and B: At2g30210-EYFP signal (A) and bright field view (B) of BY2 cells transiently expressing At2g30210-EYFP. C and D: EYFP signal (C) and bright field view (D) of BY2 cells transiently expressing EYFP alone as a control. E and F: At2g30210-EYFP signals (E) and differential interference contrast image (F) of root tip of 5-day-old Arabidopsis seedling expressing At2g30210-EYFP. Note that EYFP fluorescence, shown in green, was localized to the cell periphery.

–  –  –

The impact of abiotic stress on expression of three Arabidopsis LMCO genes was followed using quantitative PCR. The results showed that expression of all three LMCO genes was slightly up-regulated by excess copper. At2g30210 LMCO gene expression was not affected by changes in iron levels. However, the gene was up-regulated in seedlings grown on MS medium lacking sucrose, a response that was consistent with the phenotype previously observed for mutants of this gene. Although mutations in this gene increased the sensitivity of plants to salt stress, transcription of At2g30210 did not respond to salt concentration. These results are consistent with a possible function for the At2g30210 gene product in the endodermis.

–  –  –

Laccase or laccase–like multicopper oxidase (LMCOs) were first discovered in plants over 100 years ago, but relatively little is known about the physiological function(s) of these enzymes in vivo. Wound healing through oxidative polymerization of alkylcatechols in the sap of lacquer trees is the only strongly supported physiological function advanced for plant LMCOs to date (Mayer and Staples 2002, McCaig et al. 2005).

Although the Enzyme Commission definition for LMCOs (pdiphenol:O2 oxidoreductase) is based on their ability to oxidize para-substituted diphenols, one of the unusual characteristics of LMCOs is their enzymatic activity against a broad range of organic and inorganic substrates (Sterjiades et al.1993, Dean and Eriksson 1994, Hoopes and Dean 2001). This unusual characteristic of LMCOs makes it difficult to identify their precise physiological function(s) in vivo. Earlier studies have focused on their ability to oxidize phenolic compounds, especially lignin precursors, from which they have been proposed to be involved in lignin biosynthesis (Dean and Eriksson 1994, Mayer and Staples 2002). However, recent demonstration of ferroxidase activity in a LMCO from yellow-poplar (Hoopes and Dean 2004) was taken to suggest that some plant LMCOs might take part in iron metabolism in a fashion similar to the FET3p component of the high-affinity iron uptake system in yeast.

–  –  –

have the ability to oxidize various metal ions, including Cu1+, Mn2+, and Fe2+, implying the possible function of these enzymes in metal homeostasis (Brouwers et al. 1999, Roberts et al.2002, Herbik et al. 2002, Stoj and Kosman 2003, Shi et al. 2003, Hoopes and Dean 2004, Harris et al. 2004). Furthermore, those LMCOs associated with metal oxidation have been shown to be regulated by their corresponding metals at either transcriptional and/or post-transcriptional level.





To investigate the possible involvement of plant LMCOs in iron metabolism, we monitored the expression of three plant LMCO genes in Arabidopsis seedlings treated with various metal ions.

The Arabidopsis At2g30210 knockout mutant (GT7855), which requires exogenous sugar for proper development and has altered sensitivity to salt, was also analyzed in this study using quantitative PCR.

Materials and Methods All samples were harvested from two-week-old seedlings of Arabidopsis (ecotype Columbia) grown vertically on semi-solid medium in Petri plates. Light was provided on a 16-h/8-h light/dark cycle. Standard medium was 1X Murashige and Skoog salts (Invitrogen, Carlsbad, CA), ph 5.7, containing 1% (w/v) sucrose. For metal treatments, media containing 100µM cupric

–  –  –

compare with the 10µM Cu2+ and 100µM Fe2+ in standard MS medium.

Seedlings were also germinated and grown on media containing three different concentrations of sucrose (0%, 1%, and 4.5%, w/v) or sodium chloride (0, 20mM, and 40mM), respectively. Each treatment and RNA extraction was replicated in two independent experiments. Total RNA was extracted from whole seedlings using Trizol reagent (Invitrogen) as described previously. RNA samples from each replicate were pooled to obtain a single RNA sample for cDNA preparation. Protocols for cDNA synthesis and qPCR were as described previously (Chapter 3). For qPCR measurements, in addition to the previously described qPCR primers for the At2g30210 gene, primer sets specific for two additional LMCO genes, At5g58910 (5’- AGAAACACCGTTGGAGTTCC-3’ and 5’GACGAATGCCATCTTTAATCC-3’), and At5g07130 (5’GAGTTCTTGGTTCAAAGCAGAG-3’ and 5’-ACATCTCAGACGCCTTTACC-3’), as well as the iron transporter gene, IRT1 (5’GTCTTGGCGGTTGTATCCTC and 5’-GTAAACAGTTGATAGAGCGATCC-3’), were used to analyze gene expression in the different experiments.

Microarray data mentioned in this study were retrieved from the GENEVESTIGATOR server at https://www.genevestigator.ethz.ch (Zimmermann et al. 2004). Massively parallel signature sequencing (MPSS) data were retrieved from the Arabidopsis MPSS website (http://mpss.udel.edu/at/) (Meyers et al. 2004).

–  –  –

Effect of metal treatment on LMCOs To examine the impact of metal stress on LMCO expression, two-week-old Arabidopsis seedlings grown on excess copper or iron, or in the absence of iron, were compared to seedlings grown on standard medium. An At2g30210 LMCO knockout mutant (GT7855) was also grown under the same conditions to compare with wild-type plants. No significant phenotypes were noted under any of these conditions, except more lateral roots in the mutant, as reported in our earlier study (Chapter 3).

In the presence of excess copper, all three LMCOs showed slight increases in transcription, although the At5g07130 response was not significantly different from controls (Figure 4.1). Copper is an essential micronutrient, serving as a cofactor for numerous enzymes, including LMCOs. However, being a redox-active transition metal, it is also cytotoxic through its propensity to generate reactive oxygen species (ROS) in aerobic cells (Singh et al. 2004). Elevated LMCO transcription seems to be a nearly universal response to increases in copper concentration as the same phenomenon was reported for LMCOs produced by a variety of other organisms (Kim et al. 2001, Herbik et al. 2002, Shi et al. 2003, Singh et al 2004). Shi et al. (2003) suggested that bacterial LMCOs provide a defense against copper toxicity through cuprous oxidase activity acting

–  –  –

2003). Biochemical studies have shown that some LMCOs catalyze the oxidation of Cu1+ to Cu2+, thereby controlling the concentration of copper and maintaining the redox balance in plasma (Brouwers et al. 2000, Shi et al. 2003). It is unclear whether Arabidopsis LMCOs also possess the cuprous oxidase activity found in LMCOs from yeast and bacteria. However, it is plausible that increases in LMCO levels could play a role in accumulating and sequestering excess copper due to the unique structure of these enzymes that enables them to bind copper efficiently.

At2g30210 and its closest homologue, At5g07130, showed no changes in expression in response to either iron-excess or irondeficient conditions. However, At5g58910 gene transcription was slightly elevated in response to iron deficiency. The expression of At5g58910 is, however, relatively low compared to the other two LMCO genes studied, an observation confirmed by available microarray and MPSS data. Thus, the observed change could not be classified as statistically significant. In contrast, the strong inductive response of the IRT gene to iron deficiency confirmed that the treatments were appropriate to test specific gene responses to iron levels.

In Arabidopsis, At2g30210 is the LMCO gene most strongly expressed in root tissues, according to microarray and MPSS

–  –  –

associated with the At2g30210 gene product (Chapter 2). The high-affinity iron uptake system in yeast is induced by iron deficiency, and its expression is relatively low under normal growth conditions (Askwith et al. 1996). Thus, these results together strongly suggest that the At2g30210 gene product is not involved in iron metabolism. That said, there are another 12 LMCO genes, not included in this study, that also express in root tissues with various intensities revealed by available microarray data (see Figure 1.5, Chapter 1). Further study to screen the entire LMCO family in Arabidopsis will be necessary to determine whether any of the other genes are regulated by iron. Those members occurring in the same phylogenetic group as the Liriodendron LMCO that was shown capable of oxidizing ferrous iron in vitro will be of particular interest (Hoopes et al. 2004, McCaig et al. 2005).

Effect of sugar treatment on At2g30210 gene expression Because of the previously noted growth defect related to sugar availability in the At2g30210 mutant, GT7855 (see Chapter 3), we hypothesized that expression of this gene would respond to sugar levels. Without exogenous sucrose, At2g30210 gene expression in wild-type plants was significantly up-regulated compared to plants grown on medium containing 1% sucrose (Figure 4.2). The result was consistent with the phenotypic response

–  –  –

indicated that the gene might play a critical role in early root development. A similar response was not observed for the At5g58910 LMCO gene.

Recently, Rogers et al. (2005) demonstrated a role for sugars in the regulation of lignin biosynthesis. Their study indicated that sugars are not merely a source of carbon skeletons for lignin precursors, but also function as a signal for increased lignin synthesis. Many of the lignin biosynthetic genes were upregulated when seedlings were grown in the dark on medium supplemented with sucrose. However, LMCO genes were not mentioned in the report (Rogers et al. 2005). After retrieving Affymetrix data from a public database (Zimmermann et al. 2004), we noted that the At2g30210 gene was up-regulated 1.7- fold on the 8k chips, but only 1.12-fold (not significant) on the 22k chips, respectively, in the study by Rogers et al. (2005). Those results conflict with our data, which showed that the At2g30210 gene was up-regulated in the absence of sucrose. The different observations between experiments may be due in part to the different growth conditions and seedling ages. In the Rogers study, seeds were germinated and grown in the dark for 6 days, which stimulated elongation of hypocotyls, a tissue where the At2g3210 gene is expressed strongly. In contrast, seedlings in our study were grown for two weeks on a long-day cycle (a 16

–  –  –

hypocotyl tissue, so the portion of tissues expressing the gene was likely less. These results suggest that in addition to sugar, At2g30210 gene expression may also be regulated by a circadian clock, as was shown for some lignin biosynthetic genes (Rogers et al. 2005).

It remains unclear exactly how sugar signaling links with lignification. Based on the proposed model (Rogers et al. 2005), starch turnover would create a pool of soluble sugar that is made available to sink tissues, like xylem or roots, for synthesis of carbon-rich compounds, such as lignin. Starch turnover would thereby create a pool of sugar that could signal for lignin biosynthesis to begin. It was also suggested that sucrose must be hydrolyzed to its component hexose monomers, particularly glucose, and that transport alone is not sufficient to stimulate lignin synthesis.

Interestingly, in addition to conserved copper-binding domains, the At2g30210 protein sequence was predicted to contain a glycosyl hydrolase family 1 domain near the C-terminus. It may be of interest to speculate on whether this LMCO could cleave sugar residues from monolignol glucosides, the transport form of lignin precursors. Release of these sugars could stimulate LMCO transcription at a time when potential phenoloxidase substrates (monolignols) are abundant.

–  –  –



Pages:     | 1 |   ...   | 10 | 11 || 13 |


Similar works:

«C u r ren t C o n c e p t s i n Minimally Invasive Surgery of the Abdomen a,b, a *, Katy L. Townsend, Milan Milovancev, DVM BVSc, MS KEYWORDS  Laparoscopy  Dog  Cat  Minimally invasive  Biopsy  Ovariectomy  Cisterna chyli ablation  Adrenalectomy KEY POINTS  Laparoscopic and laparoscopic-assisted procedures are well established in veterinary surgery, with novel minimally invasive approaches and procedures described regularly in the peer-reviewed literature.  Advances in preoperative...»

«2016 Model Information Z1000SX ABS MODEL NAME: ZX1000MGF MODEL CODE: s Model shown with panniers detached. SUPERSPORT SEDUCTION. EVERYDAY VERSATILITY The Z1000 SX offers street riding excitement wrapped in seductive full-fairing styling. The engine and chassis deliver a direct response allowing riders to feel even more connected to their ride. The Z1000 SX blends control and comfort, and the sporty handling does not come at the cost of ride comfort. The wellbalanced package further benefits...»

«Memorial to Charles Rudolph Kolb 1920-1982 GROVER E. M URRAY 4609 10th Street, Lubbock, Texas 79416 DAVID E. POPE 299 Roselawn Boulevard, Lafayette, Louisiana 70503 Dr. Charles R. (Rudolph) Kolb, a member of the Geo­ logical Society of America since 1951, died November 27. 1982, at age 62 years and 8 months. Charlie Kolb, known familiarly to many of his friends as “Rip,” a nickname derived from the effec­ tiveness of his portrayal of Rip Van Winkle in a high school play, was a native of...»

«Hong Kong Exchange and Clearing Limited and The Stock Exchange of Hong Kong Limited take no responsibility for the contents of this announcement, make no representation as to its accuracy or completeness and expressly disclaim any liability whatsoever for any loss howsoever arising from or in reliance upon the whole or any of the contents of this announcement. KECK SENG INVESTMENTS (HONG KONG) LIMITED (Incorporated in Hong Kong with limited liability) Website: www.keckseng.com.hk (Stock Code:...»

«Capital Markets Practice September 2, 2014 | Number 1736 Five Eye-Opening Facts About the Philippine US$ Bond Market The Philippine bond market differs significantly from other markets, but is expected to change as growth continues. Philippine companies 1 have become avid borrowers of funds provided by the international high yield bond market, characterized in Asia by bonds denominated in US dollars without an investment-grade rating. In fact, Philippine companies issued US$11.4 billion of such...»

«RABIES Questions and Answers May 2014 PICTURES OF RABIES CONTROL An MNR Twin Otter aircraft is used to distribute rabies vaccine baits in southern Ontario An electron microscope image of the rabies virus ONRAB® oral rabies vaccine baits 1 Table of Contents ABOUT RABIES Who do I contact? What is rabies? How is rabies spread? What are the symptoms of rabies? Are there different types of rabies? Are some strains of rabies more dangerous than others? What is the rabies situation in Ontario? How...»

«Análisis urbanístico de Barrios Vulnerables en España 28127 – Las Rozas de Madrid CONTENIDO 1.INFORMACIÓN 2006 3.1-Plano de localización de Barrios Vulnerables 2006 3.2-Ficha de descripción del municipio 2006 3.3-Catálogo de Barrios Vulnerables 2006 -Ficha estadística de cada Barrio Vulnerable. 2006 -Descripción urbanística de cada Barrio Vulnerable. 2006  2006            Rozas de Madrid (Las) 28127 Descripción del municipio: Realizado por: Gonzalo Sánchez....»

«Microsatellite Development and Application in Pigeonpea (Cajanus cajan (L.) Millsp.) Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Willhelms-Universität Bonn Vorgelegt von Damaris Achieng Odeny aus Kisumu, Kenya Bonn 2006 Angefertigt mit Genehmigung der MathematischNaturwissenschaftlichen Fakultät der Rheinischen FriedrichWilhelms-Universität Bonn 1. Referentin: Prof. Dr. Dorothea Bartels 2....»

«Psychology, 2015, 6, 1059-1066 Published Online July 2015 in SciRes. http://www.scirp.org/journal/psych http://dx.doi.org/10.4236/psych.2015.69103 A One-Session Treatment Protocol for Panic Attacks Ron Robbins, Jan Parker, Charles Tatum National University, San Diego, CA, USA Email: jparker@nu.edu Received 2 June 2015; accepted 3 July 2015; published 6 July 2015 Copyright © 2015 by authors and Scientific Research Publishing Inc. This work is licensed under the Creative Commons Attribution...»

«THE ORDER OF THE REQUIEM (PANIKHIDA) DURING PASCHA AND BRIGHT WEEK Deacon: Bless Master! Rector: Blessed is our God, always, now and ever, and unto ages of ages! People: Amen. Clergy: Christ is risen from the dead, trampling down death by death, and upon those in the tombs, bestowing life! (thrice) People: Christ is risen from the dead, trampling down death by death, and upon those in the tombs, bestowing life! (thrice) Clergy: (Paschal Stikhiri) v.1. Let God arise, let His enemies be...»

«The Creekside News 2840 Schuyler Ave Lafayette, IN 47905 765.742.0140 creeksideah@gmail.com www.CreeksideAH.com CONTENTS MAY, 2012 Section 1: What’s New At Creekside? Section 2: Overactive Thyroid Gland in Cats (Hyperthyroidism) Section 3: Flea and Tick Section 4: Geriatric Exams Recommended for Pets Over 8 years old Section 5: Anterior Cruciate Ligament Section 6: Case of the Month WHAT’S NEW AT CREEKSIDE? New faces We are most pleased to introduce to you some talented new members of our...»

«Section 6 Notable Outbreaks and Case Investigations Section 6: Notable Outbreaks and Case Investigations Contents Bacterial Diseases Bacillus anthracis — Imported Inhalation Anthrax — Pinellas County Bordetella pertussis — Fatal Pertussis Infection in a 6-Week-Old Infant — Palm Beach County Bordetella pertussis — Pertussis Outbreak among Unvaccinated Children in an Extended Family — Escambia County Capnocytophaga canimorsus — Fatal Capnocytophaga canimorsus Infection in a...»





 
<<  HOME   |    CONTACTS
2016 www.dissertation.xlibx.info - Dissertations, online materials

Materials of this site are available for review, all rights belong to their respective owners.
If you do not agree with the fact that your material is placed on this site, please, email us, we will within 1-2 business days delete him.